|
MedChemExpress
wild type pak1 Wild Type Pak1, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/PAK1%2C+Human/pm42596835-151-5-10 Average 94 stars, based on 1 article reviews
wild type pak1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Genecopoeia
human pak1 Human Pak1, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/Promoter+reporter+clone+for+Human+PAK1/pm23338047-83-19-27 Average 94 stars, based on 1 article reviews
human pak1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
OriGene
pkn1 ![]() Pkn1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/PKN1+(NM_002741)+Human+Untagged+Clone/pm28875501-54-0-6 Average 90 stars, based on 1 article reviews
pkn1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
shpak6 lentiviral particles ![]() Shpak6 Lentiviral Particles, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/PAK1+Human+shRNA+Lentiviral+Particle/10__1074_slash_jbc__m112__424770-43-2-8 Average 90 stars, based on 1 article reviews
shpak6 lentiviral particles - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
taagctagccatgtcaaataacggcctaga ![]() Taagctagccatgtcaaataacggcctaga, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/PAK1+(NM_001128620)+Human+Tagged+ORF+Clone/pm27012601-106-44-37 Average 90 stars, based on 1 article reviews
taagctagccatgtcaaataacggcctaga - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
serine threonine p21 activated kinase 1 pak1 ![]() Serine Threonine P21 Activated Kinase 1 Pak1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/PAK1+Human+siRNA+Oligo+Duplex/pmc03807332-183-24-34 Average 90 stars, based on 1 article reviews
serine threonine p21 activated kinase 1 pak1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
pak1 gfp overexpression plasmid ![]() Pak1 Gfp Overexpression Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/PAK1+(NM_001128620)+Human+Tagged+ORF+Clone/10__1158_slash_1078___0432__ccr___15___2724-60-1-7 Average 90 stars, based on 1 article reviews
pak1 gfp overexpression plasmid - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
human pkn1 transcript variant 1 ![]() Human Pkn1 Transcript Variant 1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/PKN1+(NM_213560)+Human+Tagged+ORF+Clone/us11213575-971-104-110 Average 90 stars, based on 1 article reviews
human pkn1 transcript variant 1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
human mgfp ![]() Human Mgfp, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/PAK1+(NM_001128620)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pm37258566-173-0-12 Average 91 stars, based on 1 article reviews
human mgfp - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
Enzo Biochem
purified human pak1 enzyme (#glo-110-e100) ![]() Purified Human Pak1 Enzyme (#Glo 110 E100), supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/purified+human+pak1+enzyme+++glo+110+e100+/pm16278681-183-1-8 Average 90 stars, based on 1 article reviews
purified human pak1 enzyme (#glo-110-e100) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
US Biological Life Sciences
primary monoclonal ab rabbit anti-human pak1 ![]() Primary Monoclonal Ab Rabbit Anti Human Pak1, supplied by US Biological Life Sciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/primary+monoclonal+ab+rabbit+anti+human+pak1/10__1074_slash_jbc__m116__720680-38-14-18 Average 90 stars, based on 1 article reviews
primary monoclonal ab rabbit anti-human pak1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
pak1 protein ![]() Pak1 Protein, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+pak1/PAK1+(NM_001128620)+Human+Recombinant+Protein/10__2139_slash_ssrn__3979179-263-0-6 Average 90 stars, based on 1 article reviews
pak1 protein - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: The Prostate
Article Title: The protein kinase C super-family member PKN is regulated by mTOR and influences differentiation during prostate cancer progression.
doi: 10.1002/pros.23400
Figure Lengend Snippet: FIGURE 1 Regulation of PKN kinase activity. IP-kinase assays with WT and TM mutants of PKN1 (S916A) and PKN2 (T958A). Torin inhibited the PKN kinase activity to about the same extent as mutating the TM in both PKN isoforms. B, The PKN1 TM mutant S916A has reduced kinase activity toward multiple substrates. C, Deletion of the PKN N-terminus results in constitutive histone H3 phosphorylation in vitro and in cells. D and E, The PKN1 TM mutant S916A dramatically reduces autophosphorylation as well as Histone H3 and MARCKS phosphorylation
Article Snippet:
Techniques: Activity Assay, Mutagenesis, Phospho-proteomics, In Vitro
Journal: The Prostate
Article Title: The protein kinase C super-family member PKN is regulated by mTOR and influences differentiation during prostate cancer progression.
doi: 10.1002/pros.23400
Figure Lengend Snippet: FIGURE 3 Torin and rapamycin sensitivity of PKN, AKT, and PKCα. A, Cells stably transduced with WT PKN1 were treated with a range of torin and rapamycin concentrations for 24 h, and analyzed by using pan- and phosphosite-specific antibodies. B, Cells were treated with torin and rapamycin during a time course up to 24 h and subsequently analyzed by using pan- and phosphosite- specific antibodies
Article Snippet:
Techniques: Stable Transfection, Transduction, Phospho-proteomics
Journal: The Prostate
Article Title: The protein kinase C super-family member PKN is regulated by mTOR and influences differentiation during prostate cancer progression.
doi: 10.1002/pros.23400
Figure Lengend Snippet: FIGURE 2 PKN contains a TM phosphorylated by a torin- sensitive kinase. A, Alignment of TM sequences with the predicted phosphorylated residues indicated (bold). B, Transfection of PKN1 bearing mutations in the TM (S916A), activation loop (T774E) and ATP binding pocket (K644E) probed with antibodies specific for phos-S916 and phos-T774. Including nonphospho-TM peptide during the antibody incubation reduces the detection of non- phosphorylated PKN. C, IP-blot of WT PKN1 expressed in cells treated with torin and rapamycin
Article Snippet:
Techniques: Transfection, Activation Assay, Binding Assay, Incubation
Journal: The Prostate
Article Title: The protein kinase C super-family member PKN is regulated by mTOR and influences differentiation during prostate cancer progression.
doi: 10.1002/pros.23400
Figure Lengend Snippet: FIGURE 4 Cell motility functions of PKN. A, Localization of Flag-tagged PKN1 (green) at the cleavage furrow during mitosis, imaged by confocal microscopy. B, Examples of binucleate cells generated in response to depletion of PKN1, PKN2, and Ect2 (positive control), indicative of cytokinesis failure. C, Quantification of cytokinesis failure data as a consequence of PKN1 and PKN2 depletion. D, Expression levels (immunoblotting) of PKN1 and PKN2 after siRNA depletion. E, Stable C4-2b cell lines showing that (E) ectopic expression and (F) knockdown increase and decrease, respectively, cell migration in a Boyden chamber assay (****P < 0.0001). G, Transient depletion of PKN1, PKN2, and the TORC2 subunit Rictor reduces cell invasion of PC-3 cells to a similar extent as torin treatment
Article Snippet:
Techniques: Confocal Microscopy, Generated, Positive Control, Expressing, Western Blot, Knockdown, Migration, Boyden Chamber Assay
Journal: The Prostate
Article Title: The protein kinase C super-family member PKN is regulated by mTOR and influences differentiation during prostate cancer progression.
doi: 10.1002/pros.23400
Figure Lengend Snippet: FIGURE 5 Analysis of PKN isoform expression in human prostate cancer. A, Representative IHC showing PKN1 protein levels in normal, primary tumor, and lymph node metastasis. B, PKN1 and PKN2 expression (using microarray data from reference 47) in normal prostate, primary tumor, and metastases. C, RNA expression (using RNAseq data from TCGA) of PKN1-3 isoforms, PTEN, PKCα, AKT, and select mTOR components. **P < 0.01, ***P < 0.001, ****P < 0.0001
Article Snippet:
Techniques: Expressing, Microarray, RNA Expression
Journal: The Prostate
Article Title: The protein kinase C super-family member PKN is regulated by mTOR and influences differentiation during prostate cancer progression.
doi: 10.1002/pros.23400
Figure Lengend Snippet: FIGURE 6 Pkn2 is required for embryonic development. A, Embryos from Pkn1 and Pkn2 lacZ reporter mice were stained for β- galactosidase activity, and are shown as whole mount images. Upper row: E10.5, E11.5, E11.5. Scale bars: 1.0 mm. Bottom row: E6.5, E8.5 (side and dorsal view), E9.5, E9.5. Scale bars: 0.2 mm, 0.5 mm, 1.0 mm. B, Whole mount images of Pkn2 heterozygotes and homozygous null embryos at E7.0, E7.75, and E9.5. Scale bars 0.2 mm (upper four panels) 1.0 mm. C, Whole mount images of wild-type and Pkn2 null embryos analyzed by whole mount in situ hybridization for Otx2 (E7.5) and Bra (E7.25) are shown. Scale bars: 0.2 mm
Article Snippet:
Techniques: Staining, Activity Assay, In Situ Hybridization
Journal: The Prostate
Article Title: The protein kinase C super-family member PKN is regulated by mTOR and influences differentiation during prostate cancer progression.
doi: 10.1002/pros.23400
Figure Lengend Snippet: FIGURE 7 Analysis of PKN1 overexpression in prostate. A, Immunoblots showing transgenic expression of full-length (Tg-PKN1) and constitutively active (Tg-PKN1ΔN) proteins in anterior, dorsal, lateral, and ventral lobes (AP, DP, LP, VP). B-E, H&E stained images of sections through the ventral prostates from mice of the indicated genotypes are shown. The ages of the mice are as follows: WT, 53 weeks; Tg-PKN1, 58 weeks; Tg-PKN1ΔN, 58 weeks; Tg-AKT1, 52 weeks; Tg-AKT1;Tg-PKN1, 41 weeks; Tg-AKT1;Tg-PKN1ΔN, 52 weeks; TRAMP and TRAMP;Tg-PKN1, 16 weeks (showing HGPIN); TRAMP and TRAMP;Tg-PKN1, 17 weeks (showing small cell carcinoma). All images were captured at 200× magnification. Lower magnification views of the same samples are also provided (Supplemental Figure S3)
Article Snippet:
Techniques: Over Expression, Western Blot, Transgenic Assay, Expressing, Staining
Journal: The Prostate
Article Title: The protein kinase C super-family member PKN is regulated by mTOR and influences differentiation during prostate cancer progression.
doi: 10.1002/pros.23400
Figure Lengend Snippet: FIGURE 8 Analysis of PKNs in Pten null prostate tumors. H&E stained images of sections through the prostates from mice of the indicated genotypes are shown. All images were captured at 200× magnification and are of the ventral prostate, except for the right-most image in panel D, which shows squamous differentiation from the anterior prostate. The ages of the mice (panels A–C) are as follows: Ptenr/r, 12 and 45 weeks; Ptenr/r;Tg-PKN1, 12 and 43 weeks; Ptenr/r;Pkn1r/r;Pkn2r/r, 26 and 45 weeks. D, The images of invasive cancer (left and middle) are from 53-week ventral prostates, the squamous differentiation shown to the right is from the anterior prostate of a 53-week animal. Lower magnification views of the same samples are also provided (Supplemental Figure S4)
Article Snippet:
Techniques: Staining
Journal: Journal of Biological Chemistry
Article Title: P21 Activated Kinase-1 (Pak1) Promotes Prostate Tumor Growth and Microinvasion via Inhibition of Transforming Growth Factor β Expression and Enhanced Matrix Metalloproteinase 9 Secretion
doi: 10.1074/jbc.m112.424770
Figure Lengend Snippet: FIGURE 1. Pak1 controls micrometastasis of prostate cancer cells. a and b, Western blot analysis showing expression levels of Pak1 and Pak6 in human prostate cancer LNCaP, PC3, LNCaP C4-2, and VCaP cell lines normalized to -actin. c, stable human prostate cancer (PC3) cells expressing shRNA for scrambled (control), Pak1, or Pak6 were made using lentiviral particles following selection with puromycin. Control PC3 cells as well as those expressing ShPak1 and ShPak6 were also transiently transfected with control vector (pBabe-Puro) or constitutively active Pak1 (CA-Pak1, Pak1 E423). c, Western blot analysis of control and transfected PC3 cells with antibodies specific for Pak1, Pak6, and -actin. d and e, transendothelial migration (microinvasion) of prostate cancer (PC3) cells was measured using ECIS equipment with human dermal microvascular endothelial cells plated on 8W10E array chips (14). Control and transfected PC3 cells, detached from the plate by using cell dissociation buffer (20 mM EDTA in PBS (pH 7.4)) to avoid receptor loss because of trypsin digestion, were directly added onto the endothelial cell monolayer at a density of 5 104 cells/well in 50 l serum-free DMEM. Real-time measurements on the transendothelial migration of PC3 cells were recorded by the ECIS up to 5 h. Data are presented as mean S.D. n 3 of triplicate experiments. *, p 0.001; , p 0.01; #, p 0.05 versus control experiments within the same group.
Article Snippet: ShPak1 and
Techniques: Western Blot, Expressing, shRNA, Control, Selection, Transfection, Plasmid Preparation, Migration
Journal: Journal of Biological Chemistry
Article Title: P21 Activated Kinase-1 (Pak1) Promotes Prostate Tumor Growth and Microinvasion via Inhibition of Transforming Growth Factor β Expression and Enhanced Matrix Metalloproteinase 9 Secretion
doi: 10.1074/jbc.m112.424770
Figure Lengend Snippet: FIGURE5.Pak1isamorepotentmediatorofprostatetumorgrowthandangiogenesisinvivothanPak6.aandb,stablehumanprostatecancer(PC3)cells expressing shRNA for scrambled (control), Pak1, or Pak6 were implanted subcutaneously into athymic nude mice (Harlan, Indianapolis, IN) at a concentration of 1.5 106 cells in 100 l of sterile saline (16). Images show tumor xenographs collected on day 20. The levels of Pak1 and Pak6 protein expression in the tumor lysates was verified by Western blot analysis. c, tumor measurements were made using a caliper on every fourth day after tumor cell administration until day 20. Shown is quantification of the growth of Sh-control, ShPak1-expressing, and ShPak6-expressing tumor xenografts. The data are presented as mean S.D. n 8. , p 0.01; #, p 0.05 versus control group. d, tumors were collected, and weight was measured on day 20. The bar graph shows quantification of tumor weight (g) on day 20. The data are presented as mean S.D. n 8. *, p 0.001. e, tumor angiogenesis was measured by fluorescent immunohistochemistry analysis of frozen tumor sections using antibodies specific for laminin, and the slides were viewed under a Zeiss fluorescent microscope. Shown are laminin- positive blood vessels in the frozen sections of Sh-control, ShPak1-expressing, and ShPak6-expressing PC3 tumor xenografts. f, bar graph showing quantifica- tion of the vascular area using ImageJ software. The data are presented as mean S.D. n 8. , p 0.01; #, p 0.05.
Article Snippet: ShPak1 and
Techniques: Expressing, shRNA, Control, Concentration Assay, Sterility, Saline, Western Blot, Immunohistochemistry, Microscopy, Software
Journal: Journal of Biological Chemistry
Article Title: P21 Activated Kinase-1 (Pak1) Promotes Prostate Tumor Growth and Microinvasion via Inhibition of Transforming Growth Factor β Expression and Enhanced Matrix Metalloproteinase 9 Secretion
doi: 10.1074/jbc.m112.424770
Figure Lengend Snippet: FIGURE 6. Both Pak1 and Pak6 are necessary for prostate cancer cell proliferation, but only Pak1 is necessary for motility. a, stable human prostate cancer (PC3) cells expressing shRNA for scrambled (control), Pak1 or Pak6, or PC3 cells expressing CA-Pak1 were subjected to proliferation assays. The bar graph shows proliferation of PC3 cells after expression of control vector (pBabe-Puro and Sh-Scrambled), CA-Pak1, ShPak1, and ShPak6, respectively, or in combina- tion of ShPak1 with ShPak6 and CA-Pak1 with a rate of proliferation determined by the measurement of the amount of BrDU incorporated into the PC3 cells (Roche). b, stable human prostate cancer (PC3) cells expressing ShRNA for scrambled (control), Pak1 or Pak6, or PC3 cells expressing CA-Pak1 were subjected to colony (foci) formation assays. The bar graph shows quantification of colonies formed by PC3 cells after expression of control vector (pBabe-Puro), CA-Pak1, ShPak1, and ShPak6, respectively, or in combination of ShPak1 with ShPak6 and CA-Pak1 with ShPak6. c, shown are day 20 PC3 tumor (Scrambled, Sh-Pak1, and ShPak6) xenograft frozen sections stained with Ki67 antibodies. d, bar graph showing the number of Ki67-positive cells in day 20 PC3 tumor (Scrambled, Sh-Pak1, and ShPak6) xenograft frozen sections. e, images of PC3 cells treated with 0, 5, 10, and 15 M of Pak1 inhibitor IPA3 stained with phalloidin. f, PC3 cells were treated with 0, 5, 10, and 15 M of Pak1 inhibitor IPA3 and were subjected to a migration assay utilizing a monolayer scratch recovery assay. Cells were plated on 12-well pates precoated with fibronectin (0.5 g/well) and treated with 50 M EGF (R&D Systems). All data are presented as mean S.D. n 4 of quadruplicate experiments. *, p 0.001; , p 0.01; and #, p 0.05.
Article Snippet: ShPak1 and
Techniques: Expressing, shRNA, Control, Plasmid Preparation, Staining, Migration